live4dramaoy0yf9 live4dramaoy0yf9

01-06-2019
Mathematics

contestada

Help with this question, please!! I don't understand it

Help with this question please I dont understand it class=

Respuesta :

01-06-2019

X+60 /2=50
Multiply both sides by 2
X+60=100
Subtract 60 from both sides
X=40

Answer Link

Otras preguntas

As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D

Hafsah is feeling upset lately. Which questions should Hafsah ask herself to determine whether she needs to seek professional mental health services? Check all

from what you have heard about modern war

When you prepare to make a left turn from a one-way road into a two-way road, you must:?

What is the value of x?

In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The number of degrees of freedom for a test cross of an ss/rr individual would be

If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?

Classify this triangle... sides 4 ,7, 10