jadefleriot jadefleriot

02-04-2020
Mathematics

contestada

Sandy bought 630 crayons that came in packs of 15 how many packs of crayons did sandy buy

Respuesta :

xXcOINXx1 xXcOINXx1

02-04-2020

Answer:

42 Packs

Step-by-step explanation:

630 divided by 15

Answer Link

autumnrjames1 autumnrjames1

02-04-2020

Answer:

42

Step-by-step explanation:

you divide 630 by 15 i look like this written out [tex]630/15[/tex]

Answer Link

Otras preguntas

What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36

How and where (at what latitudes) do atmospheric convection cells form?

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?

What is let’s read a book in French

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254

Write one or two sentences about the main idea or purpose of the article.

Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2

What is the area of this composed figure

Today many educators would like math instruction to be more active and engaging instead of based on rote memory of principles and definitions. a. True b. Fals