JodinegsGerardirt
JodinegsGerardirt JodinegsGerardirt
  • 03-10-2016
  • English
contestada

a pronoun that introduces a question is called a(n) _____ pronoun.

Respuesta :

Аноним Аноним
  • 04-10-2016
An interrogative pronoun introduces a question. We know that because when you interrogate someone you ask them questions. So when a question is asked with a pronoun introducing it then it's an interrogative pronoun.
Answer Link

Otras preguntas

Why was wilson not able to finish his speaking tour
does a human body use neon???
4.2meters= how many centimeter
how to i do 7/16÷(31/2÷1/2)
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup