ajm34759
ajm34759 ajm34759
  • 02-12-2020
  • Mathematics
contestada

2 5/6 x 2/5 ???????????

Respuesta :

jojoe1111
jojoe1111 jojoe1111
  • 02-12-2020
1.13 hope this helps
Answer Link
sahil06patel sahil06patel
  • 02-12-2020

Answer:

[tex]\frac{17}{15}[/tex]

Step-by-step explanation:

Answer Link

Otras preguntas

First one that knows the answer wins brainliest
range of 12 13 19 16 32 15 13
People were asked what U.S. cities they liked to visit. The circle graph displays the responses of 50 people. Based on the circle graph, how many people said th
A food diagram is provided. Which of the following organisms depend only on producers for energy? A. Diatoms B. Shrimp C. Amphipods D. Squid
Eva's friends and her husband think that it's important that she get a mammogram at her next annual checkup. Eva believes that it will be relatively easy for he
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
which of the compounds, C3H8, mgcl2, OCl2 are expected to exist as molecular compounds?
Barry answered 32 out of 40 questions correctly on his math test. what percent of the questions did he get correct
Solve y^2 = -64, where y is a real number
How many calories must be absorbed by 20.0 g of water to increase its temperature from 383.0 C to 303.0 C