Stef118
Stef118 Stef118
  • 02-02-2021
  • Mathematics
contestada

Find the value of the variables I’ll mark the brainiest!

Find the value of the variables Ill mark the brainiest class=

Respuesta :

irjt
irjt irjt
  • 02-02-2021

Answer:

x=15, y=12, z=20

Step-by-step explanation:

y is the geometric mean of the two segments it divides.

9 · 16 = y^2

y=12

Use the pythagorean theorem to find x and z.

16^2 + 12^2 = z^2

z^2 = 400

z=20

9^2 + 12^2 = x^2

x^2 = 225

x=15

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
2) True or False: Maps always accurately represent the size and shape of landmasses and the distance between them.
Which type of evidence should victims collect to help officials catch cyber bullies?home addressesbirthdayssocial media usernamesuser passwords
“If Today were Sunday, we wouldn’t go to school.” They said to me, She said to me, “If I were you, I wouldn’t tell her about this.” “There would not be enough
what does hamlet see as degrading to the nobility of humans?
The first city to be occupied by the British army in 1768 was Boston. What was significant about this city? A. It is where the Declaration of Independence would
Which organizational pattern best fits an essay that responds to this prompt? Between The Martian Chronicles and Fahrenheit 451, which of Ray Bradbury's works h
HELPPPPPPPP MEEEEEEE
I need help With a geomarty math problem
the author argues that emancipation in northern states occurred