artellcompton97 artellcompton97
  • 01-11-2016
  • Health
contestada

Just like wearing a seat belt in a car, it is important to go to the doctor and dentist for regular checkups once every

Respuesta :

KawaiiKalin
KawaiiKalin KawaiiKalin
  • 01-11-2016
every 6 months it's recommended to have doctor and dental check-ups.
Answer Link
msanchez255515 msanchez255515
  • 01-11-2016
This statement is very true. Because without a seat belt there is a big possibility of you loosing your life. It is important to go to the doctors to make sure you are healthy and the dentist as well. 
Answer Link

Otras preguntas

testosterone directly affects the
define concentric circles
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
What was religion like in Shang China?
p(x) x^3+x^2-x-1 Find all zeros of p (x)
What is the sum of 6/10 plus 7/12
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert