savannahunterr
savannahunterr savannahunterr
  • 03-02-2022
  • Mathematics
contestada

3. Find x. 5, x, x+2

​

3 Find x 5 x x2 class=

Respuesta :

markicedagoat markicedagoat
  • 03-02-2022
From me I got 5x^3 + 2
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the name for the transfer of genetic information from one bacterium to another bacterium by a phage? select one: a. transduction b. translation c. penet
Insulin is a protein that is used by the body to regulate both carbohydrate and fat metabolism. a bottle contains 425 ml of insulin at a concentration of 20.0 m
Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc
Alice spent 6 minutes on each factoring problem and 3 minutes on each evaluation problem. she spent a total of 42 minutes on 9 problems. how many minutes did sh
-6.8 + (-12) + (-72.3).
Please help I'm trying to figure out 4-15 but i don't know how to.
which function has the solution set shown in the graph?
Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?
Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2