chrisk5nmkeyeathy chrisk5nmkeyeathy

01-04-2017
Mathematics

contestada

What is the probability that the first card is a king and the second card is a king?

Respuesta :

Scarce01 Scarce01

03-04-2017

It is a 4 out of 52 chance.

Answer Link

Otras preguntas

Which country is the world’s largest producer of wheat? USA China Russia France

which of the following statements agrees with the second law of thermodynamics

great Britain is an example of a core nation True or False

Adrien needs to use an effective sanitizer to finish cleaning a piece of equipment; he should use a_____ A.sanitizer at a temp of 60F B.sanitizer that has more

Where did the majority of people t ravel from who were heading to make a new life out of the west?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s

Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2

great Britain is an example of a core nation True or False

1. Read this excerpt from The Narrative of the Life of Frederick Douglass. I could not approach her as I was accustomed to approach other white ladies. My early